View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_11 (Length: 290)
Name: NF10259_low_11
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 276
Target Start/End: Original strand, 23447145 - 23447394
Alignment:
| Q |
16 |
agagcaacaatctaggtactgtaattgcttctctccccttaaaccggagcaatttatcattcttgattgcgatccttcatggttgcactatgttccaaga |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
23447145 |
agagcaacagtctaggtactgtaattgcttctctccccttaaaccggagcaatttatcattcttgatcgcgat-----------gcattatgttccaaga |
23447233 |
T |
 |
| Q |
116 |
acaaaatccactttattaatggcactttgccaagaccatctaatgaagatcatgactccaagactgttgcaacaccatggttatgtcatggattaatagt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23447234 |
acaaaatccactttattaatggcagtttgccaagaccatctaatgaagatcatgactccaagactgttgcaacaccatggttatgtcatggattaatagt |
23447333 |
T |
 |
| Q |
216 |
tcagtgaacgctgaaattgcctgaagcatgttctagatggatactgttactgaaattcccc |
276 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23447334 |
tcagtgaacgctaaaattgactgaagcatgttctagatggatgctgttactgaaattcccc |
23447394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University