View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_17 (Length: 250)
Name: NF10259_low_17
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 40174877 - 40175119
Alignment:
| Q |
1 |
aaaaaggttttgattgttgcgttattaatttggattctgtaggattcgtaatgccggtaac-aacttcatgtaattaaggtcgcaatgcatgcaaattag |
99 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40174877 |
aaaaaggttttgactgttgcattattaatttggattttgtaggattcgtaatgccggtaactaacttcatgtaattaaggttgcaatgcatgcaaattag |
40174976 |
T |
 |
| Q |
100 |
tggggtatcaggggctagattgaagggtgtaaaggggttgtccatttagaattctagtcatctattagactattaatttgcacacgccatctatttatgg |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40174977 |
tggggtatcagggactagattgaagggtgtaaaggggttgtccatttagaattgcagtcatctattaggctattaatttgcacacgcaatctatttatgg |
40175076 |
T |
 |
| Q |
200 |
ctacatatggcttgaatatctggctcttattgcatatctctgc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40175077 |
ctacatatggcttgaatatctggctcttattgcatatttctgc |
40175119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University