View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10259_low_18 (Length: 246)

Name: NF10259_low_18
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10259_low_18
NF10259_low_18
[»] chr6 (1 HSPs)
chr6 (172-222)||(31405898-31405948)
[»] chr5 (1 HSPs)
chr5 (72-100)||(2591599-2591627)


Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 172 - 222
Target Start/End: Complemental strand, 31405948 - 31405898
Alignment:
172 ttgttcatccaaaattcacttattagtagggttagagtgcacaccattgtt 222  Q
    |||||| |||||||| |||||||||||||||||||||||||||||| ||||    
31405948 ttgttcttccaaaatgcacttattagtagggttagagtgcacaccaatgtt 31405898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 100
Target Start/End: Original strand, 2591599 - 2591627
Alignment:
72 agaacagacaatgaaataaaaaactattg 100  Q
    |||||||||||||||||||||||||||||    
2591599 agaacagacaatgaaataaaaaactattg 2591627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University