View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_22 (Length: 236)
Name: NF10259_low_22
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_22 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 12 - 236
Target Start/End: Original strand, 40174324 - 40174554
Alignment:
| Q |
12 |
cattacacaggttaccaagcatcagaattgcaggaatgtgttgagggattgcatttgttgtaccacaatggctatcatagttcaccttccattactgcta |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40174324 |
cattacacaggttaccaagcatcagaattgcgggaatgtgttgagggattgcatttgttgtaccgaaatggctatcatagttcaccttccattactgcta |
40174423 |
T |
 |
| Q |
112 |
tcagagagaaatacagtcagcataaggtgagaatacccggctcttgttctcttgtttacgagtgtagtaaaattgagtgactaaaa--ag----cagtct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| || || ||| |
|
|
| T |
40174424 |
tcagagagaaatacagtcagcataaggtgagaatacccggctctttctctcttgtttacgagtgtagtaaaattgggtgactaaaagcagtctacactct |
40174523 |
T |
 |
| Q |
206 |
tcaatcacaatccttagttctaagcattttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40174524 |
acaatcacaatccttagttctaagcattttt |
40174554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University