View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_24 (Length: 230)
Name: NF10259_low_24
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 85 - 171
Target Start/End: Complemental strand, 11232326 - 11232240
Alignment:
| Q |
85 |
ataaccaaacacgaaaataaattacatttttaatttgattattggttagtagtgtgaaaactaagtcacgatgtattcgtctaggac |
171 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11232326 |
ataatcaaacacaaaaataaattacatttttaatttgattattggttagtagtgtgaaaactaagtcacgatgtattcctctaggac |
11232240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 34 - 134
Target Start/End: Original strand, 5245818 - 5245919
Alignment:
| Q |
34 |
taatgcaaattataataaatgaaccgaacacatgtaaaggtaaaaactaaaataaccaaacacgaaaataaattaca-tttttaatttgattattggtta |
132 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
5245818 |
taatgcaaattataataaatcaaccgaacacatgtaaaggtgaaaactaaaataaccaaacacgaaaacaatttacattttttaatttgattattagtta |
5245917 |
T |
|
| Q |
133 |
gt |
134 |
Q |
| |
|
|| |
|
|
| T |
5245918 |
gt |
5245919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 5245775 - 5245803
Alignment:
| Q |
18 |
ataaagaggtataatctaatgcaaattat |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5245775 |
ataaagaggtataatctaatgcaaattat |
5245803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University