View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_25 (Length: 229)
Name: NF10259_low_25
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41359128 - 41358918
Alignment:
| Q |
1 |
tcaacaggtactcttttgactattatattcatatgttagtttttggaattttcctcatgaattttcattgtattcatgnnnnnnnnn--atacaatggat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41359128 |
tcaacaggtactcttttgactattatattcatatattagtttttggaattttc-------------attgtattcatgtttttttttttatacaatggat |
41359042 |
T |
 |
| Q |
99 |
ttgatgttagaatgaggggtggccactgggtttacagccactgcatgcaaggatggagattgttagtaattggaacaactctggatcaatgtcatttaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41359041 |
ttgatgttagaatgaggggtggccactgggtttacagccactgcatgcaaggatggagattgttagtaatgggaacaactctggatcaatgtcatttaac |
41358942 |
T |
 |
| Q |
199 |
accttgctcagtgattctccttct |
222 |
Q |
| |
|
|||||||| |||| |||| ||||| |
|
|
| T |
41358941 |
accttgcttagtggttcttcttct |
41358918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University