View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_27 (Length: 221)
Name: NF10259_low_27
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 2 - 221
Target Start/End: Complemental strand, 23447763 - 23447559
Alignment:
| Q |
2 |
tttctattctacaatttctttaagtttatgttctaatatgatgataggaatttaatagaagagatttacgcattaaaagttcattgcccatttgttagga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
23447763 |
tttctattctacaatttctttaagtttatattctaatattatgataggaatttaatagaagagatttacgcattaaaagttcattgctcagttgtt---- |
23447668 |
T |
 |
| Q |
102 |
gtgcagtagtttacatttttgataaatagcttgagacctgtttgaactttgaaccaacctgagtttgaaaaatcagaacaatggctctgtatataacttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23447667 |
-----------tacatttttgataaatagcttgagacctgtttgaactttgaaccaacctgagtttgaaaaatcagaacaatggctctgtatgtaacttg |
23447579 |
T |
 |
| Q |
202 |
accacaattttcaaaaatgc |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
23447578 |
accacaattttcaaaaatgc |
23447559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University