View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_3 (Length: 366)
Name: NF10259_low_3
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 81 - 286
Target Start/End: Complemental strand, 17977379 - 17977179
Alignment:
| Q |
81 |
tataactacaaacccgcaaggaaacaagaacaacaaaatactccaatagagagagaaacccgcaatgattctctcaaaaaataaataaacccgcaatgat |
180 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977379 |
tatagctacaaacccgcaaggaaacaggaactacaaaata-----atagagagagaaacccgcaatgattctctcaaaaaataaataaacccgcaatgat |
17977285 |
T |
|
| Q |
181 |
tagttggatatacgagtcactctcaaagtcggtgtcttacaaacctatttgcctatttatatcaaaagtctgaaaaccctaatcatatacattccttatt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17977284 |
tagttggatatacgagtcactctcaaagtcggtgtcttacaaacctatttgcctatttatatcaaaagtctgaaaaccctaatcatatacattccttatt |
17977185 |
T |
|
| Q |
281 |
cgagtt |
286 |
Q |
| |
|
|||||| |
|
|
| T |
17977184 |
cgagtt |
17977179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University