View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_7 (Length: 308)
Name: NF10259_low_7
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 39668583 - 39668783
Alignment:
| Q |
16 |
catttggatccatcggaagaatatgcgggtcttggcaaaaaaggttccnnnnnnngtagaggagnnnnnnn-ggttccatttgaaattgatatgttaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39668583 |
catttggatccatcggaagaatatgcgggtcttggcaaaaaaggttcctttttttgtaaaggaaaaaaaaaaggttccatttgaaattgatatgttaaat |
39668682 |
T |
 |
| Q |
115 |
aaaataaaaggatttaatgcaaagcaggtttagtcgatgcggggacctacaataatcatcaattcaattttaagcattattttgtagtctttgcctatac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39668683 |
aaaataaaaggatttaatgcaaagcaggtttagtcgatgcggggacctacaataatcatcaattcaattttaagcattattttgtagtctttgcctatac |
39668782 |
T |
 |
| Q |
215 |
a |
215 |
Q |
| |
|
| |
|
|
| T |
39668783 |
a |
39668783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 241 - 305
Target Start/End: Original strand, 39669697 - 39669761
Alignment:
| Q |
241 |
aactaaaagtaaattagtgctatattatacacaaatttattttttagcatcggatcaatatatca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39669697 |
aactaaaagtaaattagtgctatattatacacaaatttattttttaacatcggatcaatatatca |
39669761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University