View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10259_low_8 (Length: 304)
Name: NF10259_low_8
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10259_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 40741898 - 40742004
Alignment:
| Q |
18 |
cacctgtggtatgaaaattggtatatctgcaagtgaaaaatagtgtgcagggatagaatgacaggcctctaactagattattgtgaaaaataaatcttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741898 |
cacctgtggtatgaaaattggtatatctgcaagtgaaaaatagtgtgcagggataaaatgacaggcctctaactagattattgtgaaaaataaatcttta |
40741997 |
T |
|
| Q |
118 |
ggaataa |
124 |
Q |
| |
|
||||||| |
|
|
| T |
40741998 |
ggaataa |
40742004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University