View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1025_high_4 (Length: 276)
Name: NF1025_high_4
Description: NF1025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1025_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 30419143 - 30419375
Alignment:
| Q |
30 |
catttggtttctaaactgcaacatcattctacggcaaacaaaatacaataccatcgtttattaaaatatgggcatgtatatattttgcatttggatctct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30419143 |
catttggtttctaaactgcaacatcattctacggcaaacaaaatacaataccatcgtttattaaaatatgggcatgtatatattttgcatttggatctct |
30419242 |
T |
 |
| Q |
130 |
ctgaacatagtaacagatgcaaccattaacacaatcgcggagagtgaaacagnnnnnnntgttctcatgacagcaattcaaaacagagataaagatggtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30419243 |
ctgaacatagtaacagatgcaaccattaacacaatcgcggagagtgaaacaaaaaaaaatgttctcatgacagcaattcaaaacagagataaagttggtg |
30419342 |
T |
 |
| Q |
230 |
taaaatggacaaacaatccaaactactttcatt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30419343 |
taaaatggacaaacaatccaaactactttcatt |
30419375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University