View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1025_high_5 (Length: 249)
Name: NF1025_high_5
Description: NF1025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1025_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 20380490 - 20380299
Alignment:
| Q |
1 |
actccctcatgtccactttgcttaacagctcttctaactgcttctttgtaattttgatcttcacctcggttgtcattttggcgggagcaccgttgctttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20380490 |
actccctcatgtccactttgcttaacagctcttctaactgcttctttgtaattttgatcttcacctcggttgtcattttggtgggagcaccgttgctttt |
20380391 |
T |
|
| Q |
101 |
ggacgtgcaatcgctttcggatgcctggaaataccagtcatcgtcgtcggtcgcatatttcgttgatgattgattcttcaagcagtttccca |
192 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20380390 |
ggacgtgcaatcgccttcggatgcctggaaataccagtcatcgtcgtcggtcgcatatttggttgatgattgattcttcaagcagtttccca |
20380299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 20390404 - 20390213
Alignment:
| Q |
1 |
actccctcatgtccactttgcttaacagctcttctaactgcttctttgtaattttgatcttcacctcggttgtcattttggcgggagcaccgttgctttt |
100 |
Q |
| |
|
||||||| ||||| |||||||| |||| |||||||||||||||||| ||||| || |||||||||||||||||| ||||||| | ||||| |||||||| |
|
|
| T |
20390404 |
actcccttatgtcaactttgctcaacaactcttctaactgcttcttcgtaatctttatcttcacctcggttgtcgttttggcagcggcaccattgctttt |
20390305 |
T |
|
| Q |
101 |
ggacgtgcaatcgctttcggatgcctggaaataccagtcatcgtcgtcggtcgcatatttcgttgatgattgattcttcaagcagtttccca |
192 |
Q |
| |
|
||||||| |||||| ||||||||| ||||||| ||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20390304 |
ggacgtgtaatcgccttcggatgcttggaaatcccactcatcgtcatcggtcgcatatttgattgatgattgattcttcaagcagtttccca |
20390213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 9 - 67
Target Start/End: Complemental strand, 20413391 - 20413333
Alignment:
| Q |
9 |
atgtccactttgcttaacagctcttctaactgcttctttgtaattttgatcttcacctc |
67 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20413391 |
atgtccactttgcttaacaactcttctaactgcttctttgtaatcttgatcttcacctc |
20413333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 20399477 - 20399378
Alignment:
| Q |
1 |
actccctcatgtccactttgcttaacagctcttctaactgcttctttgtaattttgatcttcacctcggttgtcattttggcgggagcaccgttgctttt |
100 |
Q |
| |
|
||||||| |||||||||||||| |||| ||||||||| |||||||||| ||||| ||||||||||| || || ||||||| | ||||||||||||||| |
|
|
| T |
20399477 |
actcccttatgtccactttgctcaacaactcttctaattgcttctttgagatttttatcttcacctcagtagttgttttggcagcagcaccgttgctttt |
20399378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University