View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1025_low_23 (Length: 237)
Name: NF1025_low_23
Description: NF1025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1025_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 30370607 - 30370480
Alignment:
| Q |
1 |
aaagacaaaacatgagaaagtgagtgatcgaatggaatgataaagaaggaaccttttggcttaggtttcttggagaagatattgagattcttcatcatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370607 |
aaagacaaaacatgagaaagtgagtgatcgaatg-aatgataaagaatgaaccttttggcttaggtttcttggagaagatattgagattcttcatcatcg |
30370509 |
T |
|
| Q |
101 |
tatttcttgtctccaaattcttcacacac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30370508 |
tatttcttgtctccaaattcttcacacac |
30370480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University