View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1025_low_24 (Length: 212)
Name: NF1025_low_24
Description: NF1025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1025_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 53 - 210
Target Start/End: Complemental strand, 41034856 - 41034699
Alignment:
| Q |
53 |
attcccacaatgagtttttcaagtcatgtgaattattagaagggtcttgaagtgcaatcaatgctgcaactaatccagcattgcttgatatggttggctc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41034856 |
attcccacaatgagtttttcaagtcatgtgaattattagaagggtcttgaagtgcaatcaatgctgaaactaatccagcattgcttgatatggttggctc |
41034757 |
T |
|
| Q |
153 |
cgtgaaccttttgttgcttctctgatcagtaaaatgatcatttgtctctgctcctcct |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
41034756 |
cgtgaaccttttgttgctcctctgatcagtaaaatgatcatttgtgtctggtcctcct |
41034699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University