View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1025_low_7 (Length: 403)
Name: NF1025_low_7
Description: NF1025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1025_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 7 - 216
Target Start/End: Complemental strand, 42206587 - 42206377
Alignment:
| Q |
7 |
gatcgagggaccaaacattcgtaat-gtatggtttctttcttaaagaaaaaagaatgaaacctatcaaaggcattagcattgtaagttcgaagcgtacca |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
42206587 |
gatcgagggaccaaacattcgtaatcgtatggtttctttcttaaagaaaaaataatgaaacctatcaaacgcattagcattgtaagttcgaagcgtaaca |
42206488 |
T |
|
| Q |
106 |
tataagcaaacgtgaatgactgtgctatttatagagatgcttttcttatgggctttttgcggccaactacctttttctttacggtcattgctttataaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42206487 |
tataagcaaacgtgaatgactgtgctatttatagagatgcttttcttatgggctttttgcggccaactacctttttctttacggtcattgctttataaac |
42206388 |
T |
|
| Q |
206 |
ccctaccatta |
216 |
Q |
| |
|
||||||||||| |
|
|
| T |
42206387 |
ccctaccatta |
42206377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 320 - 386
Target Start/End: Complemental strand, 42206320 - 42206254
Alignment:
| Q |
320 |
ggttgcttaacatgtgttttaggacacaaattagcatgacctttattttaatattgtagtggaacca |
386 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42206320 |
ggttgcttaacatgtgctttaggacacaaattagcatgacctttattttaatattgtagtggaacca |
42206254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University