View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-11 (Length: 89)
Name: NF1026-Insertion-11
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 6e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 34014710 - 34014629
Alignment:
| Q |
8 |
ctttactttgtggatttccattttcaagaacttcaactactgcaagaacaccgccttcttccgatgttaacgaaactattcc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34014710 |
ctttactttgtggatttccattttcaagaacttcaactactgcaagaacaccgccttcttccgatgttaatgaaactattcc |
34014629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University