View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-12 (Length: 82)
Name: NF1026-Insertion-12
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 8e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 8e-36
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 46211006 - 46211081
Alignment:
| Q |
7 |
aattatatgaaaattacttcaaatagcataattatgtcactgctctttcttgacaaaaaatatatctcactgctcg |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46211006 |
aattatatgaaaattacttcaaatagcataattatgtcactgctctttcttgacaaaaaatatatctcactgctcg |
46211081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University