View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-14 (Length: 71)
Name: NF1026-Insertion-14
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 9e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 9e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 7120350 - 7120307
Alignment:
| Q |
8 |
aactgaacaacaacgcaatgatcagctggatgtgcaatggtagc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7120350 |
aactgaacaacaacgcaatgatcagctggatgtgcaatggtagc |
7120307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University