View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-19 (Length: 85)
Name: NF1026-Insertion-19
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-19 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 20812592 - 20812515
Alignment:
| Q |
8 |
tgatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt |
85 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20812592 |
tgatagagttctggagtattctgcagcgagaggacaggttcagatattttacaggatatcaaattgcagcagcatttt |
20812515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 5e-22
Query Start/End: Original strand, 9 - 85
Target Start/End: Complemental strand, 20814500 - 20814424
Alignment:
| Q |
9 |
gatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt |
85 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
20814500 |
gatagagtttcggagtattctgcagcgacaggacagattcagatattttacaggatatcaaaatgcatcagcatttt |
20814424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 21458785 - 21458708
Alignment:
| Q |
8 |
tgatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt |
85 |
Q |
| |
|
|||||| |||||||||||||||| | || |||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21458785 |
tgatagcgttttggagtattctggagcgacaggacagattcagatattttacaggatatcaaattgcatcagcatttt |
21458708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University