View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-2 (Length: 618)
Name: NF1026-Insertion-2
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-147; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 8 - 295
Target Start/End: Original strand, 7904052 - 7904344
Alignment:
| Q |
8 |
caaagtacagagataaaaatgattcatatcaagaagaaatttatatgaattgaatgaataaaaggagaagaggttacaaggaggtttatatagctccctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904052 |
caaagtacagagataaaaatgattcatatcaagaagaaatttatatgaattgaatgaataaaaggagaagaggttacaaggaggtttatatagctccctc |
7904151 |
T |
|
| Q |
108 |
tgtcattacagttacagctgatatgaatagttctttctaatttggatccactaacaagtggctatgtaaactcagctgatgttggtaagtactgtgctga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904152 |
tgtcattacagttacagctgatatgaatagttctttctaatttggatccactaacaagtggctatgtaaactcagctgatgttggtaagtactgtgctga |
7904251 |
T |
|
| Q |
208 |
ctcagctagtgtgacta-----ttacccccctcaagctggaggttgaaaaatattgatcaaacccagcttggaaatatgatcgtggatgtgga |
295 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7904252 |
ctcagctagtgtgactattaccttacccctctcaagctggaggttgaaaaatattgatcaatcccagcttggaaatatgatcgtggatgtgga |
7904344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 338 - 496
Target Start/End: Original strand, 7904343 - 7904503
Alignment:
| Q |
338 |
gactatgagaaggaactggaaggaggtgcatcagaccctctttggaccttctctcgaacgatatgacaatcaatatcaagatgtttcgttcattcataca |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
7904343 |
gactatgagaaggaactggaaggaggtgcatcagaccctctttggaccttctctcgaacgatatgacaatcaatatcaagatgtttcgttcgttcataga |
7904442 |
T |
|
| Q |
438 |
acacggggtttgtggc--tatgtaacgcgctctggttgtcacaatatagaatggacaaacg |
496 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7904443 |
acacggggtttgcggcgatatgtaacgcactctggttgtcacaatatagaatggacaaacg |
7904503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 528 - 618
Target Start/End: Original strand, 7904504 - 7904594
Alignment:
| Q |
528 |
tatgtgagccattggagtttgcgggtggctgatgctaaagcacgatattccgctttggaggaagaacaagaaacggtgggttgcttcttgg |
618 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| |||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
7904504 |
tatgtgagccattggagttcgcggatggctgatgctaaagcatgatattccgcttcggaggaagaacaagaaacgatggattgcttcttgg |
7904594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University