View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1026-Insertion-7 (Length: 211)
Name: NF1026-Insertion-7
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1026-Insertion-7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 36941864 - 36941669
Alignment:
| Q |
8 |
gtaacataaatcattgtatcacattaggcatacatcaatgaatcacatgtctaattatagcatccgtttgcaggttgctcgtggatcttatcatttatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36941864 |
gtaacataaatcattgtatcacattaggcatacatcaatgaatcacatgtctaattatagcatccgtttgcaggttgctcgtggatcttatcatttatca |
36941765 |
T |
 |
| Q |
108 |
gtcgagcaactgaatttctcttctcagcatgagaagttgtctccaacaatttcagcaggaagtttatcaacttctcttggtagcactgtcttctagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
36941764 |
gtcgagcaactgaatttctcttctcagcatgagaagttgtctccaacaatttcagcaggaagtttatcaacttctcttggaagcact-tcttctagt |
36941669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University