View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_high_27 (Length: 236)
Name: NF10260_high_27
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 8804587 - 8804364
Alignment:
| Q |
1 |
ttttttgtttctt-gtttgtgtttcaacctcaaatccacaacactgcatttccgaggtattgtttgttttggccttgtgtggaaggtgccttgttgaatt |
99 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8804587 |
ttttttgtttctttgtttgtgattcaacctcaaatccacaacacagcatttccgaggtattgtttgttttggccttgtgtggaaggtgccttgttggatt |
8804488 |
T |
 |
| Q |
100 |
gaggaatgtgagtgttgtttataaaatactattgactccgattcctaaacattgtaggattttttgtctaccggaaccgtttgttctatattc-attttc |
198 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||| || ||||||||||||| |||||||||| ||||||||| ||||||||||||||| |||| | |
|
|
| T |
8804487 |
gaggaatgtgagcgttgtttataaactactattggctcggactcctaaacattgtgggattttttgagtaccggaacagtttgttctatattcaatttcc |
8804388 |
T |
 |
| Q |
199 |
tattcaaattcaaatggtcgaatc |
222 |
Q |
| |
|
||||| |||||||||||| ||||| |
|
|
| T |
8804387 |
tattcgaattcaaatggttgaatc |
8804364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University