View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_high_33 (Length: 221)
Name: NF10260_high_33
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 31772819 - 31772627
Alignment:
| Q |
15 |
attcacaactaggtttcctcatgaaaggtacgagaccgcgataaagccgcagggttggcatacatcagcggtgacgttccaactgagtgattcatgtcct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31772819 |
attcacaactaggtttcctcatgaaaggtacgagaccgcgataaagccgcagggttggcatacatcagcggtgacgttccaaccgagtgattcatgtcct |
31772720 |
T |
 |
| Q |
115 |
ttcccttggactgaaatccattgaacatgcctcctccattgagagaattggccttgtcattattgatcccaagctttgaccataatgaactct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31772719 |
ttcccttggactgaaatccattgaacatgcctcctccattgagagaattggccttgtcattattgatcccaagctttgaccataatgaactct |
31772627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University