View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10260_low_20 (Length: 409)

Name: NF10260_low_20
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10260_low_20
NF10260_low_20
[»] chr1 (2 HSPs)
chr1 (1-244)||(41708447-41708697)
chr1 (328-397)||(41708295-41708364)
[»] chr8 (1 HSPs)
chr8 (328-397)||(9744202-9744271)
[»] chr7 (2 HSPs)
chr7 (328-377)||(28082204-28082253)
chr7 (328-397)||(24538822-24538891)
[»] chr5 (1 HSPs)
chr5 (328-397)||(16420687-16420756)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 41708697 - 41708447
Alignment:
1 tcatggtgaaaagatgggtagcttaattacttgaagacatagccaacaacttaatgaatgactttaattgagaatttgatcgtggaacacttgatttc-- 98  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||       
41708697 tcatggtgaaaagatgggtagcttgattacttgaagacatagccaacaacttaatgaatgactttaattgagaattttatcgtggaacacttgatttgct 41708598  T
99 -----aaatcctatttattgtcacgtcatatatcttaatataatacacaattttatgaatctgctgggac--tttttctaagcataaattatgcggactc 191  Q
         |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||  ||||| ||||||||||||||||||| |     
41708597 acgtgaaatcctatttattgtcacgtcatatatcttaatatcatacacacttttatgaatctgcagggactttttttttaagcataaattatgcggagta 41708498  T
192 gagaggtttcccactgcacaatcctaatcatattaatagaaagatgaaagtat 244  Q
    ||||||||| |||  |||||| |||||||||||||||||||||||||||||||    
41708497 gagaggttttcca--gcacaaccctaatcatattaatagaaagatgaaagtat 41708447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 328 - 397
Target Start/End: Complemental strand, 41708364 - 41708295
Alignment:
328 aagagggaccgctatcccctaaaaactagcgagacgatcggttggaagaaccaatcttaaaccctttgct 397  Q
    ||||||||| ||||||| ||||||||||| ||||||||| ||||||||||||||||||||| ||||||||    
41708364 aagagggactgctatcctctaaaaactagtgagacgatctgttggaagaaccaatcttaaatcctttgct 41708295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 328 - 397
Target Start/End: Original strand, 9744202 - 9744271
Alignment:
328 aagagggaccgctatcccctaaaaactagcgagacgatcggttggaagaaccaatcttaaaccctttgct 397  Q
    |||||||||||| ||||| |||||||||| ||| |||||||||||||||||||| ||| |||||||||||    
9744202 aagagggaccgcaatcccttaaaaactagtgaggcgatcggttggaagaaccaaccttgaaccctttgct 9744271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 28082253 - 28082204
Alignment:
328 aagagggaccgctatcccctaaaaactagcgagacgatcggttggaagaa 377  Q
    ||||||||||||||||||||||||||||||||| ||||| ||| ||||||    
28082253 aagagggaccgctatcccctaaaaactagcgaggcgatcagtttgaagaa 28082204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 328 - 397
Target Start/End: Original strand, 24538822 - 24538891
Alignment:
328 aagagggaccgctatcccctaaaaactagcgagacgatcggttggaagaaccaatcttaaaccctttgct 397  Q
    |||| ||||| ||||| | ||||||||| |||| || ||||||||||||||||| ||| |||||||||||    
24538822 aagatggaccactatctcttaaaaactaacgaggcgttcggttggaagaaccaaccttgaaccctttgct 24538891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 328 - 397
Target Start/End: Complemental strand, 16420756 - 16420687
Alignment:
328 aagagggaccgctatcccctaaaaactagcgagacgatcggttggaagaaccaatcttaaaccctttgct 397  Q
    |||||||||| ||||||| |||||||||||||| || || |||||||||||||| ||  |||||||||||    
16420756 aagagggaccactatcccttaaaaactagcgaggcgctcagttggaagaaccaacctcgaaccctttgct 16420687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University