View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_35 (Length: 330)
Name: NF10260_low_35
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 221 - 324
Target Start/End: Original strand, 31635360 - 31635464
Alignment:
| Q |
221 |
agcaaaagttaatattggt-agtaattgtaccaaaagttagttttagtagtaattgttatatattgatagtaaagaatgaaccttcattcaaatttcttc |
319 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
31635360 |
agcaaaagttaatattttttagtgattgtaccaaaagttaattttagtagtaattgttatctattgatagtaaagaatgaaccttcattcaatttttttg |
31635459 |
T |
|
| Q |
320 |
tcact |
324 |
Q |
| |
|
||||| |
|
|
| T |
31635460 |
tcact |
31635464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 324
Target Start/End: Original strand, 31620402 - 31620469
Alignment:
| Q |
257 |
ttagttttagtagtaattgttatatattgatagtaaagaatgaaccttcattcaaatttcttctcact |
324 |
Q |
| |
|
|||||||| |||||||||||||| |||| | |||| |||||||||| |||||||| ||||| ||||| |
|
|
| T |
31620402 |
ttagttttggtagtaattgttatctattaaaagtatagaatgaaccctcattcaatcttcttgtcact |
31620469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University