View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_52 (Length: 282)
Name: NF10260_low_52
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 9e-39; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 39219901 - 39219820
Alignment:
| Q |
1 |
tccctaacatcatcaataggctcaaaatccatgattcaactgtgcaaactgaaaagcttcagcaagtgtaaaatcctgggaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39219901 |
tccctaacatcatcaataggctcaaaatccatgattcaactgtgcaaactgaaaagcttcagcaagtgtaaaatcctgggaa |
39219820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 143 - 235
Target Start/End: Complemental strand, 39219759 - 39219667
Alignment:
| Q |
143 |
tctaggtcaaattgaatcatcaagtaatacattgattttctagaaacaaacccaaacaataaacagagcaatgtaaacacgggtaaatctttc |
235 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39219759 |
tctaggtcaaattgaatcctcaagtaatacatttattttctagaaacaaacccaaacaataaacatagcaatgtaaacaggggtaaatctttc |
39219667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 267
Target Start/End: Complemental strand, 39219432 - 39219399
Alignment:
| Q |
234 |
tctagaatttgattttgcaatttgagaagagagt |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
39219432 |
tctagaatttgatttttcaatttgagaagagagt |
39219399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University