View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_58 (Length: 267)
Name: NF10260_low_58
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_58 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 28915360 - 28915111
Alignment:
| Q |
18 |
atatttagtcattgacgaatgatgaatgatcttgatcaacaacaaacaatgcttaaaatgggtgagtactgaagaagatatgagtgttgcatgtcttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28915360 |
atatttagtcattgacgaatgatgaatgatcttgatcaacaacaaacaatgcttaaaatgggtgagtactaaagaagatatgagtgttgcatgtcttttt |
28915261 |
T |
 |
| Q |
118 |
tctaagagagtttgctcacaattcaagcacacaaatgttcacgctaaaatgtgtttaaaaatttaaataggctatgatttgtagctttaaaaaatataaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28915260 |
tctaagagagtttgctcacaattcaagcacacaaatgttcacgctaaaatgtgtttaaaattttaaataggctatgatttgtagctttaaaaaatataaa |
28915161 |
T |
 |
| Q |
218 |
atatgatttgagttcttccccaaaatcggagaaaaatatgttttattttt |
267 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28915160 |
atatgatttgagttcttcgccaaaatcggagaaaaatatgttttattttt |
28915111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University