View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_62 (Length: 250)
Name: NF10260_low_62
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 13202871 - 13202629
Alignment:
| Q |
4 |
ctcatgttttgtgtttattctaaattacaaaatgctttcagttttgcttcgat-ataactattgtaagatatgatgaaatagacaatattacacagtttc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13202871 |
ctcatgttttgtgtttattctaaattacaaaatgctttcagttttgcttcgatgataactattgtaagatatgatgaaatagacaatattacacagtttc |
13202772 |
T |
 |
| Q |
103 |
aaaggtaaaatttccttttgtagacacatgagccttatagattcttttgcattgtaggagtggctgcaggaatatactcgggcctaacatatgggctgaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13202771 |
aaaggtaaaatttccttttgtagacacatgagccttatagattcttttgcattgcaggagtggctgcaggaatatactccggcctaacatatgggctgaa |
13202672 |
T |
 |
| Q |
203 |
ggaagctcgaggaactcatgactgggtaaatgcctttgcttct |
245 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
13202671 |
ggaagctcgaggagctcatgactgggtaaatgcctttgtttct |
13202629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 163 - 231
Target Start/End: Original strand, 50326029 - 50326097
Alignment:
| Q |
163 |
tggctgcaggaatatactcgggcctaacatatgggctgaaggaagctcgaggaactcatgactgggtaa |
231 |
Q |
| |
|
||||||||||| |||| || || || ||||||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
50326029 |
tggctgcaggactatattcaggactcacatatgggatgaaggaagctcgtggtactcatgactgggtaa |
50326097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University