View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_66 (Length: 248)
Name: NF10260_low_66
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 28917301 - 28917516
Alignment:
| Q |
13 |
ttgttgtccttattagcaagataatataatacgagaaaagtttgttctctaaatttcaacatttaaaattttaa-ttatataaaatactaatagaaactt |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
28917301 |
ttgttgtccttactagcaagataatataatacgagaaaactttgttctctaaatttcaacatttaaaattttaacttatataaaatactaatataaactt |
28917400 |
T |
 |
| Q |
112 |
gatgaaagttcaagacgaaatcaagaaagtnnnnnnnnnnnntcgaaatagcaacatgtattacctcaatagttgtgtgatggattttgaaaccgtttga |
211 |
Q |
| |
|
|||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28917401 |
gatggaagttcaagacgaaatcaagcaagtaaaaaagaaaaatcgaaatagcaacatgtattacctcaatagttgtgtgatggattttgaaaccgtttgg |
28917500 |
T |
 |
| Q |
212 |
acttagaaaatggtta |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28917501 |
acttagaaaatggtta |
28917516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University