View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_72 (Length: 241)
Name: NF10260_low_72
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 15112963 - 15112857
Alignment:
| Q |
1 |
atagtaaaccttagcttgagtcgttgtaatcgtactgaaatgctattgtttatcttattactaatagttattattagatgaacgaagtaactacactatt |
100 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
15112963 |
atagtaaaagttagcttgagtcattgtaatcatactgaaatgctatcgtttatcttattactactatttattattagatgaacgaagtaactacactatt |
15112864 |
T |
 |
| Q |
101 |
ctcatat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
15112863 |
ctcatat |
15112857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University