View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_73 (Length: 237)
Name: NF10260_low_73
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 25781035 - 25781176
Alignment:
| Q |
25 |
tctcttttgatttctctttagatcttcttttgggttgagagttgggaaaagggacaaaggttagcgtttgttcatggagagtttttaaagctaatttctt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25781035 |
tctcttttgatttctctttagatcttcttttgggttgagagttgggaaaaggtataaaggttagcgtttgttcatggagagcttttaaagctaatttctt |
25781134 |
T |
|
| Q |
125 |
gtaacttctttatatctcatgtaaaaagtcgtgaatagtgaa |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25781135 |
gtaacttctttatacctcatgtaaaaagtcgtgaatagtgaa |
25781176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 25781272 - 25781326
Alignment:
| Q |
164 |
gaatttactttacacatcattgcttgttgtttgcttgaattatatggttattgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25781272 |
gaatttactttacacatcattgcttgttgtttgcttgaattatatggttactgat |
25781326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University