View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_74 (Length: 236)
Name: NF10260_low_74
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_74 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 43036981 - 43036763
Alignment:
| Q |
18 |
aatgaatgaaccatgaaaactggcactcaccacacaccaccaatatttcattttcgtacannnnnnncttcttctatggtgtgggcgaattttggaatgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43036981 |
aatgaatgaaccatgaaaactggcactgaccacacaccaccaatatttcattttcgtacatttttttcttcttctatggtgtgggcgaattttggaatgg |
43036882 |
T |
 |
| Q |
118 |
aaaatttgattgacaatgacactttattgttgctaatatctaccaatatactttgcaaataaaaatatctacaagtaaatgtatgaaaattgttatgaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43036881 |
aaaatttgattgacaatgacactttattgttgctaatatctaccaatatactttgcaaataaaaatatctacaagtaaatgtatgaaaattgttatgaat |
43036782 |
T |
 |
| Q |
218 |
tcggactcaaaactcacac |
236 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
43036781 |
ttggactcaaaactcacac |
43036763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 236
Target Start/End: Original strand, 12739345 - 12739381
Alignment:
| Q |
200 |
atgaaaattgttatgaattcggactcaaaactcacac |
236 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
12739345 |
atgaatattgttgtgaattcggactcaaaactcacac |
12739381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 236
Target Start/End: Original strand, 4160055 - 4160087
Alignment:
| Q |
204 |
aaattgttatgaattcggactcaaaactcacac |
236 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
4160055 |
aaattgttgtgaattcggactcaaaactcacac |
4160087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University