View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10260_low_76 (Length: 235)

Name: NF10260_low_76
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10260_low_76
NF10260_low_76
[»] chr6 (2 HSPs)
chr6 (76-235)||(3225885-3226043)
chr6 (1-44)||(3225810-3225853)


Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 76 - 235
Target Start/End: Original strand, 3225885 - 3226043
Alignment:
76 tacgtgtttgataacacagtgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacagcgacatta 175  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
3225885 tacgtgtttgataacaca-tgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacggcgacatta 3225983  T
176 aggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggct 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3225984 aggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggct 3226043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3225810 - 3225853
Alignment:
1 tttttgaatcatcgataagtgattagcatggtgcaataatagat 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
3225810 tttttgaatcatcgataagtgattagcatggtgcaataatagat 3225853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University