View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_76 (Length: 235)
Name: NF10260_low_76
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_76 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 76 - 235
Target Start/End: Original strand, 3225885 - 3226043
Alignment:
| Q |
76 |
tacgtgtttgataacacagtgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacagcgacatta |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3225885 |
tacgtgtttgataacaca-tgagtttgccagaagcacggagaaccattgtgatatcaaacatgcacgaatagtgatacatacatgtgaacggcgacatta |
3225983 |
T |
|
| Q |
176 |
aggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225984 |
aggtcatgagcaactccttcaggaattggaacatatgtttcaacagcaactttatgggct |
3226043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3225810 - 3225853
Alignment:
| Q |
1 |
tttttgaatcatcgataagtgattagcatggtgcaataatagat |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225810 |
tttttgaatcatcgataagtgattagcatggtgcaataatagat |
3225853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University