View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_77 (Length: 233)
Name: NF10260_low_77
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 41275585 - 41275383
Alignment:
| Q |
16 |
tgaagagtgaagttgttttgaatttgagtgttgttgggttctgtttgaatgtgtgcatgcatgggacaatagagattgaaaaggcaatgagggaacttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275585 |
tgaagagtgaagttgttttgaatttgagtgttgttgggttctgtttgaatgtgtgcatgcatgggacaatagagattgaaaaggcaatgagggaacttgt |
41275486 |
T |
|
| Q |
116 |
tcaatgggagaatccctctagcagtatttaatttgtgtctgcatgctctcaacaaatgaaattgatcttgtcaaaaagaaatgaaatttaaatggttgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275485 |
tcaatgggagaatccctctagcagtatttaatttgtgtctgcatgctctcaacaaatgaaattgatcttgtcaaaaagaaatgaaatttaaatggttgaa |
41275386 |
T |
|
| Q |
216 |
tct |
218 |
Q |
| |
|
||| |
|
|
| T |
41275385 |
tct |
41275383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University