View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_78 (Length: 233)
Name: NF10260_low_78
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_78 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 33927222 - 33927441
Alignment:
| Q |
14 |
gcagagacaagaatcgttgaggcagtatcgggagatggtgaacggtggtagaacttgctgacgtggcagattaatccaacggtcatatcttgctgacgtg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927222 |
gcagagacaagaatcgttgaggcagtatcgggagatggtgaacggtggtagaacttgttgacgtggcagattaatccaacggtcatatcttgctgacgtg |
33927321 |
T |
|
| Q |
114 |
gttgaataatacaacggtcatgttttgctgacgtggtagatattatccaacggtttgannnnnnnggggaaatgggaaattcatggagataacagtgagc |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927322 |
gttgaataatccaacggtcatgttttgctgacgtggtagatattatccaacggtttgatttttttggggaaatgggaaattcatggagataacagtgagc |
33927421 |
T |
|
| Q |
214 |
aagggtttatttttattttt |
233 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33927422 |
aagggtttatttttattttt |
33927441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University