View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10260_low_9 (Length: 502)
Name: NF10260_low_9
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10260_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 5e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 48183641 - 48183489
Alignment:
| Q |
1 |
caatgcttctattatgttattttccttaatttgttcaagtgtgaaggatgcttctatttctttatgttgaagtataattaaaaaatgtattttacttgct |
100 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48183641 |
caatgcttcgattatgttatttctcttaatttgttcaagtgtgaaggatgcttctatttctttatgttgaagtataattaaaaaatgtattttatttgct |
48183542 |
T |
|
| Q |
101 |
attctattcttttacatttataatcctttgaatttgacagtttaacgttttag |
153 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
48183541 |
attctattcttttttgtttataagcctgtgaatttgacagtttaacattttag |
48183489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 271 - 389
Target Start/End: Original strand, 19885164 - 19885288
Alignment:
| Q |
271 |
tgtaatattgatcaactacatagctgggcatggtgact-------gtgagcactccagcacaggtcccctcaaccatcaaattccaatcacaattgcagg |
363 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||| | ||||||||||||||||| |||||||| |||| || |||||| ||||||| |||| |
|
|
| T |
19885164 |
tgtaatattgatcagctacatacctgggcattgtgatttgtgatggtgagcactccagcacaaatcccctcagccattaa-ttccaaccacaattacagg |
19885262 |
T |
|
| Q |
364 |
ggttttcaagatcaacctatgtggca |
389 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
19885263 |
atgtttcaagatcaacctctgtggca |
19885288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 352 - 388
Target Start/End: Original strand, 32576309 - 32576345
Alignment:
| Q |
352 |
cacaattgcaggggttttcaagatcaacctatgtggc |
388 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32576309 |
cacaattgcagggtgtttcaagatcaacctatgtggc |
32576345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University