View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_high_7 (Length: 411)
Name: NF10261A_high_7
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 409643 - 409833
Alignment:
| Q |
9 |
tggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctacagctaatactattgctgctgctgaacat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
409643 |
tggtgttgggattgataatgtggatctacaagctgctactgaatttggttgtcttgttgtgaatgctcctactgctaatactattgctgctgctgaacat |
409742 |
T |
 |
| Q |
109 |
gggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagcaggtatggtacatgttcatgatttatctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||| |
|
|
| T |
409743 |
gggattgctcttcttgctgctatggctcgtaacgtttctcaagctgatgcttcccttaaagctggtatggtacatttacatgatttatctt |
409833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University