View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_158 (Length: 289)
Name: NF10261A_low_158
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 55299992 - 55300247
Alignment:
| Q |
16 |
tcatcattgcagcataggaatttcttggaagctccgactagagacggcacaagtataatagtaatgaaatgttattggttgaatggtagagtaagagaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55299992 |
tcatcattgcagcataggaatttcttggaagctccaactagagacggcacaagtataatagtaatgaaatgttattggttgaatggtagagtaagagaaa |
55300091 |
T |
 |
| Q |
116 |
gaaagaaagagagaatgaaagtacctagcccgactcggaagcaatctgttggagatcgtcacatgatatcgcctactcgccacaatatgtcacgttccgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300092 |
gaaagaaagagagaatgaaagtacctagcccgactcggaagcaatctgttggagatcgtcacatgatatcgcctactcgccacaatatgtcacgttccgc |
55300191 |
T |
 |
| Q |
216 |
acggaggaggaagaacagtggtcattggtggttgtcatcaatatcatggatgaaga |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300192 |
acggaggaggaagaacagtggtcattggtggttgtcatcaatatcatggatgaaga |
55300247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University