View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_161 (Length: 286)
Name: NF10261A_low_161
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_161 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 5 - 277
Target Start/End: Original strand, 25836947 - 25837219
Alignment:
| Q |
5 |
gcgggctggtggcgagaattttcagcagtatgcacctgcgcctgtacctggacctgccgcttggggtgcatatgatatgcagcgagttcagggacatcga |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25836947 |
gcggcctggtggcgagaattttcagcagtatgcacctgcacctgtacctggacctgccgcttggggtgcatatgatatgcagcgagttcagggacatcga |
25837046 |
T |
|
| Q |
105 |
tagacttctatcctgctaagaaatcttatttccggtatcctgggctgcaactttctagattggttaggggtcctactcatgggcctcatgggaatttgtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25837047 |
tagacttctatcctgctaagaaatcttatttctggtatcctgggctgcaactttctagattgattaggggtcctactcatgggcctcatgggaatttgtt |
25837146 |
T |
|
| Q |
205 |
tcttagatgctcctcaaaatcgtatttttatcagagggttcatatcagctagagcatgcagtagatgatgttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25837147 |
tcttagatgctcctcaaaatcgtatttttatcggagggttcatatcagctagagcatgcagtagatgatgttt |
25837219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University