View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_163 (Length: 285)
Name: NF10261A_low_163
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_163 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 116 - 252
Target Start/End: Complemental strand, 15827348 - 15827214
Alignment:
| Q |
116 |
cttgactcatatgctttaacaatttcatgaagaaatcacaatagtctagcttgtctatcagcagaagtattgaggcatatcaagtgtcaagtaaaaaggt |
215 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15827348 |
cttgactcatatgctt-aacaatttcatgaagaaatcacaagagtctagcttgtctatcagcagaagtattgaggcatatcaggtgtcaagtaaaaaggt |
15827250 |
T |
 |
| Q |
216 |
atagtcttatctcaaatgcaatcatagatcacctaaa |
252 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15827249 |
atagtcttatctc-aatgcaatcatagatcacctaaa |
15827214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 19 - 123
Target Start/End: Complemental strand, 15827599 - 15827495
Alignment:
| Q |
19 |
catcaaaatacaaaatgttggttatatcataagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827599 |
catcaaaatacaaaatgttggttatatcatgagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
15827500 |
T |
 |
| Q |
119 |
gactc |
123 |
Q |
| |
|
||||| |
|
|
| T |
15827499 |
gactc |
15827495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 261
Target Start/End: Original strand, 5600618 - 5600674
Alignment:
| Q |
204 |
aagtaaaaaggtatagtcttatctcaaatgcaatcatagatcacctaaaaagagaaga |
261 |
Q |
| |
|
||||||||| || ||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
5600618 |
aagtaaaaacatagagtctcatctcaa-tgtaatcatagatcacctaaaaagagaaga |
5600674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University