View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_164 (Length: 285)
Name: NF10261A_low_164
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_164 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 8 - 285
Target Start/End: Original strand, 35486087 - 35486364
Alignment:
| Q |
8 |
ttggtgttcaaaagagtttgaggaaaactatgtgactaattatcctacacatgtttcatgtttatattatatacaatattattagttataaggggaagca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35486087 |
ttggtgttcaaaagagtttgaggaaaactatgtgactaattatcctacacatgtttcatgtttatattatatacaatattattagttataaggggaagca |
35486186 |
T |
 |
| Q |
108 |
atcatctcttaatttagagcagagctgataaacttaatcaccatgcagatgcttaactctcatgtttaattctgatacttgtaatgatttttatagtagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35486187 |
atcatctcttaatttagagcagagctgataaacttaatcaccatgcagatgcttaactctcatgtttaattctgatacttgtaatgatttttatagtagc |
35486286 |
T |
 |
| Q |
208 |
tacatgtctgtgtgcatgtggtgcatatcttcgtcattttccacttactattatgtcttgtagaccagggcggttgga |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35486287 |
tacatgtctgtgtgcatgtggtgcatatcttcgtcatttaccacctactattatgtcttgtagaccagggcggttgga |
35486364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University