View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_181 (Length: 274)
Name: NF10261A_low_181
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_181 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 24 - 266
Target Start/End: Complemental strand, 43411010 - 43410761
Alignment:
| Q |
24 |
acagacagacacaacacattcagatga---gaagttgtaagctagctag----gaggatggactgctgctgctgctgttgcggaaagtgtttggaagatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43411010 |
acagacagacacaacacattcagatgatcagaagttgtaagctagctagctaggaggatggactgctgctgctgctgttgcggaaagtgtttggaagatt |
43410911 |
T |
|
| Q |
117 |
gagaggggaagcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattcttcaagatcagcatcacatgataacaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410910 |
gagaggggaagcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattcttcaagatcagcatcacatgataacaca |
43410811 |
T |
|
| Q |
217 |
acccattctccttcatcatccaaatattttagaaccaagttgttcatatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410810 |
acccattctccttcatcatccaaatattttagaaccaagttgttcatatc |
43410761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University