View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_182 (Length: 274)
Name: NF10261A_low_182
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_182 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 23 - 274
Target Start/End: Complemental strand, 24511831 - 24511577
Alignment:
| Q |
23 |
atttaatgggatacatcttagttgtagttttgtttttctagatgaccgataggaactcttttacttcctataagt-tttagtcttttgcttattgttctt |
121 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || | ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24511831 |
atttagtgggatacatcttagttgtagttttgtttcccttgttgaccgataggaactctttcacttcctataagtatttagtcttttgcttattgttct- |
24511733 |
T |
|
| Q |
122 |
gtggttagagtttaagccc-atttattcataattaaaaaaatattcattcataatt---nnnnnnnnncatagtgcagtacaataccactctttttgttt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
24511732 |
-tggttagagtttaagccctatttattcataattaaaaaaatatttattcataattaaaaaaaaaaaacatagtgcagtacaatacgactttttttgttt |
24511634 |
T |
|
| Q |
218 |
gtttgacttgtagtattgcagtacaatacgacttatttcctttattatagccaatga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24511633 |
gtttgacttgtagtattgcagtacaatacgacttatttcctttattatagccaatga |
24511577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University