View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_185 (Length: 271)
Name: NF10261A_low_185
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_185 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 40477837 - 40478102
Alignment:
| Q |
11 |
gtgtttcatggagggcttgcactgcttttgaaatcaatctttatttctattggttgctatattatatattgagtattggaactgcaatgttacctattga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40477837 |
gtgtttcatggagggcttgcactgcttttgaaatcaatctttatttctattggtt---atattatatattgagtattggaactgcaatgttacctattga |
40477933 |
T |
|
| Q |
111 |
ttggtgaaactgtg--------ttattattgatatctcactgttttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaa |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40477934 |
ttggtgaaactgtgttattgtgttattattgatatctcactgttttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaa |
40478033 |
T |
|
| Q |
203 |
gagcagttggtgaaagtaatgttcaaattaattgttctgactaggatcaaggtggattgaccgaacttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40478034 |
gagcagttggtgaaagtaatgttcaagttaattgttctgactcggatcaaggtggattgaccgaacttg |
40478102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University