View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_186 (Length: 270)
Name: NF10261A_low_186
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_186 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 23 - 270
Target Start/End: Original strand, 42060128 - 42060375
Alignment:
| Q |
23 |
ctctcagctgctttggatgctggtattgctttcatggctgtgttgctctatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42060128 |
ctctcagctgctttggatgctggtattgctttcatggctgtgttgctctatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttg |
42060227 |
T |
|
| Q |
123 |
aggcagatgatcattgtcccttggctaaatgccctacagctcctggtattgttaccaagggatgtcccgtcttttgagcgccatatttgcgatctctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42060228 |
aggcagatgatcattgtcccttggctaaatgccctacagctcctggtattgttaccaagggatgtcccgtcttttgagcgccatatttgcgatctcttat |
42060327 |
T |
|
| Q |
223 |
atcctcattaattagtcatgaaaatatacatcaagtttgaagaataat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42060328 |
atcctcattaattagtcatgaaaatatacatcaagtttgaagaataat |
42060375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 23 - 197
Target Start/End: Original strand, 42075425 - 42075599
Alignment:
| Q |
23 |
ctctcagctgctttggatgctggtattgctttcatggctgtgttgctctatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttg |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
42075425 |
ctctcagctgctttggatgctggtgttgctttcatggctgtgttgctctattttctacttcaatcttatggtatctttggtccagcttggtggggtctta |
42075524 |
T |
|
| Q |
123 |
aggcagatgatcattgtcccttggctaaatgccctacagctcctggtattgttaccaagggatgtcccgtctttt |
197 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
42075525 |
agtcagatgatcattgtcccttggctaattgccctacagctcctggtattaaagccaagggatgccctgtctttt |
42075599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 23 - 232
Target Start/End: Original strand, 42084005 - 42084214
Alignment:
| Q |
23 |
ctctcagctgctttggatgctggtattgctttcatggctgtgttgctctatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttg |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
42084005 |
ctctcagctgctttggatgctggtgttgctttcatggctgtgttgctctattttgcacttcaatcttatgatatcattggtccagcttggtggggtctta |
42084104 |
T |
|
| Q |
123 |
aggcagatgatcattgtcccttggctaaatgccctacagctcctggtattgttaccaagggatgtcccgtcttttgagcgccatatttgcgatctctcat |
222 |
Q |
| |
|
|| |||||||||| |||||||||| ||| ||||||||||||||||||||| |||||||||| || ||||||| | | ||||| |||| ||| || | |
|
|
| T |
42084105 |
agtcagatgatcagtgtcccttggttaattgccctacagctcctggtattaaagccaagggatgccctgtcttttaaactccatagttgcattctatctt |
42084204 |
T |
|
| Q |
223 |
atcctcatta |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
42084205 |
atcctcatta |
42084214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 130
Target Start/End: Complemental strand, 36523212 - 36523153
Alignment:
| Q |
71 |
tatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttgaggcagat |
130 |
Q |
| |
|
|||||||| ||||||||||||| | | | |||||||||||||||||||||||| |||||| |
|
|
| T |
36523212 |
tatttttctcttcaatcttatggtatttatggtccaacttggtggggtcttgaagcagat |
36523153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 165
Target Start/End: Complemental strand, 36530045 - 36529954
Alignment:
| Q |
71 |
tatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttgaggcagatgatcattgtcccttggctaaatgccctacagctcc |
165 |
Q |
| |
|
|||||||| ||||||||||| | | | | |||||||||||||||||||||||| || || || || || ||||||||||||||||||||||| |
|
|
| T |
36530045 |
tatttttctcttcaatcttacggtatttatggtccaacttggtggggtcttgaacca---gaccactgccctttggctaaatgccctacagctcc |
36529954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 165
Target Start/End: Complemental strand, 36535705 - 36535566
Alignment:
| Q |
23 |
ctctcagctgctttggatgctggtattgctttcatggctgtgttgctctatttttcacttcaatcttatgatgtctttggtccaacttggtggggtcttg |
122 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||| |||| | | | || |||||||| |||||||| |||| | | ||||||||||| |||||||| |||| |
|
|
| T |
36535705 |
ctctcagctggtttagatgctggagttgcttttatgggtttagtactttatttttctcttcaatcctatggtatttttggtccaacatggtggggccttg |
36535606 |
T |
|
| Q |
123 |
aggcagatgatcattgtcccttggctaaatgccctacagctcc |
165 |
Q |
| |
|
| ||| ||||| || || ||||||| ||| ||||||||||| |
|
|
| T |
36535605 |
aagca---gatcactgccctttggctagatgtcctacagctcc |
36535566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University