View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_193 (Length: 267)
Name: NF10261A_low_193
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_193 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 7 - 267
Target Start/End: Original strand, 21642420 - 21642680
Alignment:
| Q |
7 |
actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgttatctcatggacttcactta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21642420 |
actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgtcatctcatggacttcactta |
21642519 |
T |
|
| Q |
107 |
tctccggttacactcgctccggccagccacatcagtcgatatctttattctacgaaatgttggcatttcctattcaacccaatgcttttactctatcttc |
206 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21642520 |
tctccggttacactcgctccgacctgccacatcaatcgatatctttattctacgaaatgttggcatttcctgttcaacccaatgcttttactctatcttc |
21642619 |
T |
|
| Q |
207 |
cgttattaaagcttgttctacgttgaatgacgtaaaccttgggagatgttttcattctatg |
267 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21642620 |
tgttatcaaagcttgttctgcgttaaatgacgtaaaccttgggagatgctttcattctatg |
21642680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University