View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_197 (Length: 264)
Name: NF10261A_low_197
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_197 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 245
Target Start/End: Complemental strand, 32259026 - 32258913
Alignment:
| Q |
132 |
tatcgtgaagttggcatgcggctgaaggaataccctgaagaagatgttagaaaagcaagaaaattgatttcaagcttcataagagccgctgaagaagtag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32259026 |
tatcgtgaagttggcatgcggctgaaggaataccctgaagaagatgttagaaaagcaaggaaattgatttcaagcttcataagagccgctgaagaagtag |
32258927 |
T |
|
| Q |
232 |
aagaggtaatttct |
245 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32258926 |
aagaggtaatttct |
32258913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 34899975 - 34899908
Alignment:
| Q |
13 |
atctcaacttgaaagtttaaactaccaaactttacatatgtgcatataaaaacatctctatttagttc |
80 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||| |||||||||| |||||||| |||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttc |
34899908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University