View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_198 (Length: 263)
Name: NF10261A_low_198
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_198 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 257
Target Start/End: Original strand, 4082864 - 4083112
Alignment:
| Q |
9 |
gaacaagacaaagaacatagaacaaattgtcagcaatagaaatcacttacatagataatatcttttgtcatgggaagaagattgccctatgacaatgcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082864 |
gaacaagacaaagaacatagaacaaattgtcagcaatagaaatcacttacatcgataatatcttttgtcatgggaagaagattgccctatgacaatgcca |
4082963 |
T |
|
| Q |
109 |
ataattcattgataggtccatttctatatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcg |
208 |
Q |
| |
|
| |||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082964 |
acaatttattaataggtccatttctaaatttttcattctccctaataggattagcaacaagcattgccataatcacaactctatgtagtgttcgatttcg |
4083063 |
T |
|
| Q |
209 |
aagaagaaaattgacgccgccccctacaacaccgatatcaaacaccaaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4083064 |
aagaagaaaattgacgccgccccctacaacaccgatatcaaacaccaaa |
4083112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 48203072 - 48203029
Alignment:
| Q |
170 |
cattgccataatcacaactctatgtagtgttcgatttcgaagaa |
213 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
48203072 |
cattgccataatcacaactatatgtagttttcgattccgaagaa |
48203029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University