View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_223 (Length: 254)
Name: NF10261A_low_223
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_223 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 52763369 - 52763617
Alignment:
| Q |
1 |
attaaaaaagggtagttggtaatggactcaaaacatttgtatgaacaaatcctttattagttagtattcctcttagagataggtttaagcagttgtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763369 |
attaaaaaagggtagttggtaatggactcaaatcatctgtatgaacaaatcctttattaggtagtattcctcttagagataggtttaagcagttgtttga |
52763468 |
T |
|
| Q |
101 |
gttggctgaaaatcgttggattttggcggcggagatgttttctttannnnnnnnnnnnnnnnnnnnnnnnntatgaaggcataaaagtggcggtggaggc |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
52763469 |
attggctgaaaatcgttggattttagcggcggagatgttttatttagggtgggtgggggtgggggtggggttatgaaggcataaaagtggcggtggaggc |
52763568 |
T |
|
| Q |
201 |
tgttactttgcatgttgatattgaagaccattgacgatgacaactagat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763569 |
tgttactttgcatgttgatattgaagaccattgacgatgacaactagat |
52763617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University