View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_225 (Length: 254)
Name: NF10261A_low_225
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_225 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 52478151 - 52478375
Alignment:
| Q |
7 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478151 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
52478250 |
T |
 |
| Q |
107 |
acaccatcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatattgtcggttctcaagtcatcatggctttattagagatg |
206 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478251 |
acaccatcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatattgtcggttctcaagtcatcatggctttattagagatg |
52478349 |
T |
 |
| Q |
207 |
ttacccacggttcaatttgcttcttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52478350 |
ttacccacggttcaatttgcttcttg |
52478375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University